- Research article
- Open access
- Published:
Prevalence of methicillin-resistant Staphylococcus aureus and pattern of antimicrobial resistance in mastitis milk of cattle in Chitwan, Nepal
BMC Veterinary Research volumeĀ 17, ArticleĀ number:Ā 239 (2021)
Abstract
Background
The threat of methicillin-resistant Staphylococcus aureus (MRSA) exists globally and has been listed as a priority pathogen by the World Health Organization. One of the sources of MRSA emergence is livestock and its products, often raised in poor husbandry conditions. There are limited studies in Nepal to understand the prevalence of MRSA in dairy animals and its antimicrobial resistance (AMR) profile. A cross-sectional study was conducted in Chitwan, one of the major milk-producing districts of Nepal, from February 2018 to September 2019 to estimate the prevalence of MRSA in milk samples and its AMR profile. The collected milk samples (nā=ā460) were screened using the California Mastitis Test (CMT) and positive samples were subjected to microbiological analysis to isolate and identify S. aureus. Polymerase Chain Reaction (PCR) was used to identify the presence of the mecA gene and screen for MRSA.
Results
In total, 41.5% (191/460) of milk samples were positive in the CMT test. Out of 191 CMT positive milk samples, the biochemical tests showed that the prevalence of S. aureus was 15.2% (29/191). Among the 29āS. aureus isolates, 6.9% (2/29) were identified as MRSA based on the detection of a mecA gene. This indicates that that 1.05% (2/191) of mastitis milk samples had MRSA. The antibiotic sensitivity test showed that 75.9% (22/29) and 48.3% (14/29) S. aureus isolates were found to be sensitive to Cefazolin and Tetracycline respectively (48.3%), whereas 100% of the isolates were resistant to Ampicillin. In total 96.6% (28/29) of S. aureus isolates were multidrug-resistant (MDR).
Conclusions
This study revealed a high prevalence of S. aureus-mediated subclinical mastitis in dairy herds in Chitwan, Nepal, with a small proportion of it being MRSA carrying a mecA gene. This S. aureus, CoNS, and MRSA contaminated milk poses a public health risk due to the presence of a phenotype that is resistant to very commonly used antibiotics. It is suggested that dairy herds be screened for subclinical mastitis and treatments for the animals be based on antibiotic susceptibility tests to reduce the prevalence of AMR. Furthermore, future studies should focus on the Staphylococcus spp. to explore the antibiotic resistance genes in addition to the mecA gene to ensure public health.
Background
S. aureus is an opportunistic organism that is found to colonize the skin and mucous membranes of 20ā80% of the human population permanently and without symptoms [1]. Colonization and infection of livestock by S. aureus, as well as the exchange of virulence factors between human and livestock strains have been documented [2]. The symptoms associated with this bacterium range from simple skin infections to serious conditions like endocarditis and sepsis in humans. In livestock species, the bacteria cause wound infection, osteomyelitis, post-surgical abscess, and mastitis [3]. This shows that S. aureus lacks host specificity and causes a wide range of diseases. S. aureus is a diverse organism, and it has been evolving into a more developed and resistant form [4]. One of its variants, Methicillin-resistant Staphylococcus aureus (MRSA), also known as āresistant staphā or āsuperbugā is considered one of the major bacteria causing human infections in hospital and community settings. MRSA is listed as a high priority bacterium for further research and treatment by the World Health Organization [5]. Genetic mutation and resistance of MRSA to antibiotics commonly used in the field increases challenges to health workers [6]. S. aureus and MRSA were found to be the major causative agent of mastitis in Pokhara [7] and Bhaktapur [8], whereas Coagulase Negative Staphylococci (CoNS) was the predominant organism causing mastitis in Chitwan [9]. A study at Kathmandu Medical College has shown that 25.0% of MRSA isolates from humans are found resistant to Penicillin, Oxacillin, Cephalexin, and Erythromycin, which is similar to the animal isolateās antibiotic resistance phenotype [10]. An in vitro drug sensitivity test has revealed the resistance ability of the mastitis pathogen, S. aureus, towards Ampicillin and Penicillin [11]. Thus, the above study has revealed the diverse resistance phenotype of S. aureus, particularly towards Ampicillin and Penicillin. In addition to this, the existence of a high occupational risk to the people viz. milkers, farmers, and veterinarians, having close contact with MRSA-infected cattle has also been mentioned [12]. The surveillance of such superbugs should be regularly conducted as milk is a daily consumed food and is supplied in a huge amount daily. The genetic background and antimicrobial resistance phenotype of S. aureus and MRSA from Chitwan dairy farms havenāt been studied yet. Therefore, a study was conducted to understand the prevalence and resistance characteristics of S. aureus and MRSA, and to provide help in the rational use of antibiotics.
Results
Prevalence of subclinical and serious mastitis infection in dairy cattle
At first, for determining the prevalence of MRSA in the milk samples of Chitwan, CMT positive milk samples were randomly collected. Among the CMT positive milk samples, as per the instruction of Bekuma and Galessm [13], the prevalence of subclinical and clinical mastitis were identified as 71.7% (nā=ā137/191) and 28.3% (nā=ā54/191), respectively. Overall prevalence of subclinical and clinical mastitis were 29.8% (137/460) and 11.7% (54/460), respectively. Out of 191 CMT positive milk samples cultured, the biochemical tests identified 29 milk samples (15.2%) with S. aureus and 30 (15.7%) with CoNS.
Prevalence of MRSA
The antibiotic sensitivity tests showed that 28āS. aureus isolates were resistant to Cefoxitin (30āĪ¼g) with a zone of inhibition measuring less than 21āmm. Thus, the prevalence of Oxacillin resistant S. aureus was 14.7% (28/191), but a mecA gene was detected in only two isolates (Fig.Ā 1). The overall prevalence of MRSA on a genetic basis was 1.05% (2/191). Among the S. aureus isolates, 6.9% (2/29) were identified as MRSA on a molecular basis.
Antibiogram profile of S. aureus isolates
Out of 11 antibiotics tested, 75.9% (22/29) S. aureus isolates were found to be the most sensitive to Cefazolin, while 51.7% (15/29) isolates were found to have an intermediate resistance to Erythromycin. Similarly, 100% (29/29) of the S. aureus isolate showed resistance to Ampicillin. A detailed description is provided in TableĀ 1.
Antibiogram profile of CoNS
Out of 11 antibiotics tested, 78.0% (23/30) of CoNS isolates were found to be the most sensitive to Cefazolin and 62.7% (19/30) of isolates had an intermediate response to Erythromycin. Similarly, 100% of the CoNS isolate showed resistance to Ampicillin. A detailed description is provided in Table 1.
Resistance profile of S. aureus isolates
The resistance profile of S. aureus isolates showed 23 different phenotypes. Four isolates were resistant to at least seven groups of antibiotics, whereas seven isolates were resistant to six groups of antibiotics. Three isolates showed the same phenotypic character with a resistance pattern; CIP-GEN-AMP-CD-AK-CPM-CTX-TEI-E and a Multiple Antibiotic Resistance (MAR) index of 0.8. Eleven of the isolates had a MAR index of 0.5, and nine isolates were found to have a MAR index of 0.7. An additional Excel file is provided to explain this in more detail (see AdditionalĀ fileĀ 1).
Resistance profile of CoNS
The resistance profile of CoNS isolates showed 25 different phenotypes. An isolate was resistant to a maximum number of 10 antibiotics belonging to eight groups of antibiotics. Maximum isolates showed the same phenotypic character with a resistance pattern; GEN-AMP-AK-TEI and a MAR index of 0.4. In total, 23 number of CoNS isolates were found to be multidrug-resistant. Thirteen isolates were resistant to at least five groups of antibiotics. An additional Excel file is provided to explain this in more detail (see AdditionalĀ fileĀ 2).
Resistance profile of MRSA isolates
Out of 29āS. aureus isolates, only two Oxacillin resistant MRSA (OR-MRSA) were detected with a MAR index of 0.8 and 0.9. The two resistance patterns of MRSA were CIP-GEN-AMP-CD-AK-CPM-CTX-TEI-E, and CIP-TE-GEN-AMP-CD-AK-CPM-CTX-TEI-CZ-E. The other twenty-seven S. aureus isolates were Oxacillin Resistant but mecA negative (OR- MSSA).
Species richness and MAR index of S. aureus and CoNS isolates
Out of 29āS. aureus isolates, 31.1% (9/29) were resistant to at least eight antibiotics tested, with a MAR index of 0.7, and eight isolates (27.6%) were resistant to at least six antibiotics with a MAR index of 0.5. Two isolates (6.9%) were resistant to 10 antibiotics (with a MAR index of 0.9). Out of 30 CoNS isolates, eight isolates were resistant to at least five antibiotics tested with a MAR index of 0.5. One isolate was resistant to 10 antibiotics with a MAR index of 0.9. TableĀ 2 shows the number of isolates and their MAR indices.
MDR phenotype of S. aureus and CoNS isolates
Out of 29āS. aureus isolates tested against seven groups of antibiotics, 28 (96.6%) isolates were resistant to antibiotics belonging to more than three groups of antibiotics tested and were classified as MDR isolates.
Out of 30 CoNS isolates tested against seven groups of antibiotics, 27 isolates (90.0%) were resistant to antibiotics belonging to more than three groups of antibiotics tested and were classified as MDR isolates.
Discussion
This cross-sectional study conducted in dairy farms in Chitwan district, one of the major milk-producing districts of Nepal, showed that the prevalence of sub-clinical or clinical mastitis was 41.5% (191/460). S. aureus (15.2%, 29/191 samples) and CoNS (15.7%, 30/191 samples) were identified as significant bacteria causing mastitis. In total, 1.05% (2/191) of isolates from mastitis milk and 6.9% (2/29) of S. aureus isolates were MRSA that carried a mecA gene. The majority of these isolates were found to be multidrug-resistant.
S. aureus was identified as one of the major bacteria causing mastitis in dairy cattle in this study. This finding is consistent with previous studies conducted in Nepal, which had also shown S. aureus as one of the major bacterial pathogens causing clinical and sub-clinical mastitis [16, 17]. However, these previous studies did not evaluate S. aureus isolates at the genetic level.
In this study, two mastitis milk samples (1.05%, 2/119) and 6.9% (2/29) of S. aureus samples were found to be carrying a mecA gene, thereby confirming them as MRSA. The presence of MRSA in milk from dairy cattle poses a risk to public health if preventive measures are not applied. In a similar study conducted in Tamil Nadu India, MRSA was detected in 3.0% (12/409) of the mastitis milk samples, which was slightly higher than in this study [17]. Likewise, in a study conducted in Northwestern China in 2014, a high prevalence (56.5%, 121/214) of S. aureus was determined, but only one isolate (0.46%) was determined to be MRSA, which was slightly lower than what was found in our study [18]. Similarly, seven S. aureus isolates were resistant to Oxacillin, but did not carry a mecA gene, which supports the findings of this study [18]. However, in a study conducted in four provinces of China, 47.6%(49/103) of S. aureus isolates from milk samples were identified as MRSA with the mecA gene [19], which is significantly higher than isolated in this study and other studies in the region [19, 20]. MRSA carrying the mecA gene has been found in varying proportions in different parts of the world, for example, 42.9% (nā=ā64) in Tigray, Ethiopia [20], 35.7% (nā=ā84) in Egypt [21], 9% (nā=ā728) in Karnataka, India [22], 0.8% (nā=ā363) in bulk milk tanks in England and Wales [23].
The AMR patterns of S. aureus showed that they are highly resistant to a majority of the commonly available antibiotics on the market. For example, S. aureus isolates were 100% resistant to Ampicillin and, to some degree, also resistant to Ciprofloxacin, Gentamicin, Teicoplanin, and Cefemine. The S. aureus and CoNS isolates were found to be relatively sensitive to Tetracycline and Cefazolin. In a study conducted in Ethiopia, isolates were highly resistant to Ampicillin, but were sensitive to Amikacin, Gentamycin, and Tetracycline [20]. A high level of MDR S. aureus was also found in several other studies [17, 18, 20,21,22,23,24,25]. Based on the antibiogram profile of S. aureus and CoNS, fourth-generation Cephalosporin group of antibiotic, Cefazolin, and tetracycline are the drugs-of-choice against S. aureus in mastitis. Similar results were obtained by Memon [26] in China. More than 25.0% of MRSA isolates were resistant to Penicillin, Oxacillin, Cephalexin, Co-trimoxazole, and Erythromycin [10]. The high level of AMR, including MDR, indicates irrational use of antibiotics is practiced in the dairy farms of Chitwan.
A limitation of this study is that only a mecA gene was evaluated to determine MRSA, while another gene named blaZ is also a specific gene for MRSA and responsible for resistance to Ī²-lactam antibiotics [27]. Thus, the prevalence of MRSA determined in this study might be an underestimation. Furthermore, alternative genes other than mecA, like mecALGA251 and mecC could be present in a microorganism leading to the MDR characteristic, which is supported by the study of Denmark [28]. Besides, risk factors related to the presence of MRSA were not examined and evaluated.
Conclusions
This study has revealed that S. aureus-mediated subclinical mastitis is widely prevalent in Chitwan dairy herds. Among the mastitis milk, 15.2% (29/191) of the milk samples were positive for S. aureus. Among the 29 samples tested positive for S. aureus, two samples were confirmed carrying a mecA gene, indicating the 6.9% (2/29) prevalence of a mecA gene among the S. aureus isolates in the Chitwan district. The antibiotic sensitivity pattern revealed that S. aureus was sensitive to Cefazolin and Tetracycline, but resistant to Ampicillin, Amikacin, Teicoplanin, and Gentamycin. It was found that 96.6% (28/29) of S. aureus and 90.0% (27/30) of CoNS isolates were multidrug-resistant isolates. As MRSA is also an important human pathogen, circulation of MRSA bacteria in dairy cattle poses a risk to public health.
Methods
This cross-sectional study was conducted from February 2018 to September 2019 in the Chitwan district, located in the Bagmati Province of Nepal, on 71,864 dairy cows [29]. A total of 23 farms were selected from the pocket areas: Rampur, Mangalpur, Gitanagar, Mahendrachowk, Divyanagar, and Ratnanagar, by lottery system of random sampling. Cows within the farms were selected by the same method.
The sample size formula provided by Daniel [30] was used, which is
Where,
Z: Z statistic for a level of confidence. (For the level of confidence of 95.0%, which is conventional, Z value is 1.96).
P: expected prevalence or proportion. P is considered 0.11, the herd-level prevalence of MRSA in cattle of Pokhara [7].
d: precision (d is considered 0.05 to produce good precision and smaller error of estimate).
Therefore, sample size (n)ā=ā150.4 from the total dairy cattle population of 71,864 in Chitwan.
The milk samples were collected according to the protocol of the National Mastitis Council [14] from the healthy teats of dairy cattle. After a quarter of a cattle was washed with tap water and dried, the teat end was swabbed with cotton soaked in 70.0% ethyl alcohol. Milk with a change in color and consistency was discarded. In a large herd, one cow was selected at random from the group of five cows. In total, 460 udder quarters from 115 cows were subjected to the California Mastitis Test (CMT) and the scores were given as per Bekuma and Galessm [13]. A score of ā0ā was regarded as a healthy udder quarter; score ā1ā as subclinical mastitis; score ā2ā and ā3ā as serious mastitis. A total of 191 udder quarters were CMT positive with scores 1, 2, and 3. Thus, the sample size of this study was 191. Approximately 3āml of milk was collected aseptically from CMT positive quarter into the sterile tube after discarding the first three milking streams. Those samples were transported in a thermo-cool box to the Laboratory of Veterinary Microbiology, FAVF, Rampur.
The milk samples in the thermo-cool box were thawed before pre-enrichment. One milliliter of the sample was dispensed into a test tube containing nine milliliters of sterile peptone water (M028, HiMedia, India) to make a ratio of 1:9 and was incubated at 37āĀ°C for 24āh. A loopful of the enriched peptone water was taken by a sterile inoculum loop and streaked onto Mannitol Salt Agar (MSA) (M118, Himedia, India). The streaked plate was incubated overnight at 37āĀ°C. The suspected golden-yellow colonies on MSA were sub-cultured on nutrient agar to gain a pure colony of Staphylococcus and incubated overnight at 37āĀ°C. A gram staining test, catalase test, oxidase test, coagulase test, and hemolysis test were performed for confirmation of S. aureus. An antibiotic sensitivity test for Staphylococcus spp. was performed by the Kirby-Bauer disk diffusion method on Mueller-Hinton agar [15]. An inoculum was prepared by emulsifying pure colonies in sterile normal saline (0.85%) in Eppendorf tubes with the turbidity adjusted to 0.5 McFarland standards equivalent to 1.0āĆā108ācfu/mL. The inoculum thus prepared was uniformly streaked on Mueller Hinton agar plates using sterile swabs and left for a minute prior to introduction of the antibiotics. Antibiotics commonly used in the field were selected, named as Ampicillin(AMP), Gentamycin(GEN), Erythromycin(E), Ciprofloxacin(CIP), Tetracycline(TE), Clindamycin(CD), Teicoplanin(TEI), Amikacin(AK), Cefotaxime(CTX), Cefepime(CPM), and Cefazoline(CZ). The plates were incubated at 37āĀ°C for 24āh, and the diameters of the zones of inhibition were measured, and results interpreted according to HiMedia interpretative chart [31].
Detection of Methicillin-resistant S. aureus
Cefoxitin-based methods
An antibiotic sensitivity test for S. aureus was performed with the Kirby-Bauer disk diffusion method on Mueller-Hinton agar [15] against the Cefoxitin disc of 30āĪ¼g potency. After incubation, the diameter of the zone of inhibition was recorded to the nearest millimeter of each disc by Hi Antibiotic Zone Scale (HiMedia, India) and then classified as sensitive, intermediate, and resistant according to the manufacturerās interpretative chart [31].
Polymerase chain reaction
The DNA of S. aureus was extracted using DNeasy Blood and Tissue Kit (Qiagen, German Product) and stored in a sterile Eppendorf tube. The concentration and purity of DNA extracted from S. aureus were quantified by spectrophotometer at 260ānm and 280ānm using a nano spectrophotometer (Quawell, UV-Vis Spectrophotometer, Q5000 V6.0.2). For identification and confirmation of the MRSA, the āmecAā gene of 124ābp was used as a molecular marker with an oligonucleotide sequence of forward and reverse primer GAATGCAGAAAGACCAAAGCA and TTTGGAACGATGCCTATCTCA, respectively [32].
The polymerase chain reaction (PCR) was performed using S. aureus specific methicillin-resistant gene mecA for the identification of MRSA. The reaction mixture consisted of 1āĪ¼l genomic DNA, 10āĪ¼l Hot Start Taq 2X master mix (Biolabsline), 1āĪ¼l of each primer, and the final volume was adjusted to 20āĪ¼l by adding nuclease-free water. After mixing all the components in PCR tubes, DNA was added and the tubes were placed in the Bio-Rad T100ā¢ Thermal Cycler (Bio-Rad, USA) to preheat at 95āĀ°C. A total of 40 PCR cycles were run under the following conditions: initial DNA denaturation at 95āĀ°C for 5āmin, denaturation 95āĀ°C for 1āmin, primer annealing at 52āĀ°C for 45ās, and DNA extension at 72āĀ°C for 1āmin. After the final cycle, the reaction was terminated by maintaining at 72āĀ°C for 5āmin. The PCR products were stored in the cycler at 4āĀ°C until they were collected.
The amplified PCR products were resolved by electrophoresis in 1.5% agarose gel. The agarose powder (0.9āg) was added to 60āml of 1% Tris-Boric acid āEDTA (TBE) along with 6āĪ¼l Syber safe (S33102, Invitrogen) to prepare 1.5% agarose gel. The gel was put in an electrophoresis tank (MultiSUB Electrophoresis Systems; Nano PAC-300P, Cleaver Scientific) containing 450āml of 1.0% TBE buffer. The first and last wells of the gel were loaded with 6āĪ¼l of 100ābp DNA ladder (100āĪ¼g/ml) and 1ākb DNA ladder (500āĪ¼g/ml), respectively. The rest of the wells were loaded with 6āĪ¼l of a mixture prepared by adding 2āĪ¼l of 6X DNA loading dye (Thermo Scientific) to 6āĪ¼l of sample DNA. The gel electrophoresis was then set and run at 85āV, 90A for 70 mins, and visualized under UV trans-illuminator (Platinum Q9, Uvitech Cambridge).
Data analysis
The data were recorded and maintained in Microsoft Excel 2007. A prevalence percentage was calculated by dividing the number of positive samples for the given category by the total samples tested within that category. The prevalence formula was applied for determining prevalence percentage of mastitis, S. aureus, CoNS, and MRSA. The AMR patterns, resistance, intermediate, and sensitivity were calculated using the CLSI guideline using the cut-off as provided in the brochure of the manufacturer (HiMedia, India).
Availability of data and materials
Raw data in this study were generated through CMT test, AST test and biochemical test, which are available from the corresponding author on reasonable request.
Abbreviations
- Ī:
-
Alpha
- A:
-
Ampere
- AD:
-
After Death
- AK:
-
Amikacin
- AMP:
-
Ampicillin
- AST:
-
Antibiotics Sensitivity Testing
- Bp:
-
Base pair
- Ī :
-
Beta
- CD:
-
Clindamycin
- CDC:
-
Centers for Disease Control and Prevention
- CIP:
-
Ciprofloxacin
- Cl:
-
Chlorine
- CLSI:
-
Clinical and Laboratory Standards Institute
- CM:
-
Clinical Mastitis
- CMT:
-
California Mastitis Test
- CoNS:
-
Coagulase Negative Staphylococcus spp
- CPM:
-
Cefepime
- CTX:
-
Cefotaxime
- CV:
-
Crystal Violet
- CX:
-
Cefoxitin
- CZ:
-
Cefazolin
- E:
-
Erythromycin
- GEN:
-
Gentamicin
- HA:
-
Hospital Associated
- H2O2 :
-
Hydrogen Peroxide
- I:
-
Intermediate
- Kb:
-
Kilobyte
- LA:
-
Livestock Associated
- MAR:
-
Multiple Antibiotic Resistance
- MDR:
-
Multidrug Resistant
- MHA:
-
Mueller Hinton Agar
- MRSA:
-
Methicillin Resistant S. aureus
- MSA:
-
Mannitol Salt Agar
- NA:
-
Nutrient Agar
- NB:
-
Nutrient Broth
- O:
-
Oxacillin
- OR:
-
Oxacillin Resistant
- OS:
-
Oxacillin Sensitive
- pH:
-
the negative logarithm of H+ Concentration; Acidity
- PBP:
-
Penicillin Binding Protein
- PCR:
-
Polymerase Chain Reaction
- R:
-
Resistant
- S:
-
Sensitive
- SCC:
-
Staphylococcus Cassette Chromosome
- SCM:
-
Subclinical Mastitis
- SE:
-
Staphylococcus Enterotoxin
- spp.:
-
Species
- TE:
-
Tetracycline
- Tei:
-
Teicoplanin
References
Brown AF, Leech JM, Rogers TR, McLoughlin RM. Staphylococcus aureus colonization: modulation of host immune response and impact on human vaccine design. Front Immunol. 2014;4:507. https://0-doi-org.brum.beds.ac.uk/10.3389/fimmu.2013.00507.
Fluit AC. Livestock-associated Staphylococcus aureus. Clin Microbiol Infect. 2012;18(8):735ā44. https://0-doi-org.brum.beds.ac.uk/10.1111/j.1469-0691.2012.03846.x.
Tong SY, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015;28(3):603ā61. https://0-doi-org.brum.beds.ac.uk/10.1128/CMR.00134-14.
Enright MC. The evolution of a resistant pathogenāthe case of MRSA. Curr Opin Pharmacol. 2003;3(5):474ā9. https://0-doi-org.brum.beds.ac.uk/10.1016/S1471-4892(03)00109-7.
WHO, 2017. WHO publishes list of bacteria for which new antibiotics are urgently needed. Available from: https://www.who.int/news-room/detail/27-02-2017
Xia J, Gao J, Kokudo N, Hasegawa K, Tang W. Methicillin-resistant Staphylococcus aureus antibiotic resistance and virulence. Biosci Trends. 2013;7(3):113ā21. https://0-doi-org.brum.beds.ac.uk/10.5582/bst.2013.v7.3.113.
Joshi LR, Tiwari A, Devkota SP, Khatiwada S, Paudyal S, Pande KR. Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in dairy farms of Pokhara, Nepal. Int J Vet Sci. 2014;3(2):87ā90 http://www.ijvets.com/.../87-90.pdf.
Shrestha S, Bindari YR. Prevalence of sub-clinical mastitis among dairy cattle in Bhaktapur District, Nepal. Int J Agri Biosci. 2012;1(1):16ā9 http://www.ijagbio.com/.../16-19.pdf.
Dhakal IP, Nagahata H. Evaluation of mastitis related measures & their applications to classify buffalo milk in Chitwan, Nepal. J Agri Sci Technol A. 2018;8:99ā111. https://0-doi-org.brum.beds.ac.uk/10.17265/2161-6256/2018.02.006.
Pandey S, Raza MS, Bhatta CP. Prevalence and antibiotic sensitivity pattern of Methicillin-Resistant-Staphylococcus aureus in Kathmandu Medical College-Teaching Hospital. J Inst Med Nepal. 2012;34(1):13ā7. https://0-doi-org.brum.beds.ac.uk/10.3126/jiom.v34i1.9117.
Dhakal IP. Normal somatic cell count and subclinical mastitis in Murrah buffaloes. J Veterinary Med Ser B. 2006;53(2):81ā6. https://0-doi-org.brum.beds.ac.uk/10.1111/j.1439-0450.2006.00918.x.
Loeffler A, Pfeiffer DU, Lloyd DH, Smith H, Soares-Magalhaes R, Lindsay JA. Meticillin-resistant Staphylococcus aureus carriage in UK veterinary staff and owners of infected pets: new risk groups. J Hosp Infect. 2010;74(3):282ā8. https://0-doi-org.brum.beds.ac.uk/10.1016/j.jhin.2009.09.020.
Bekuma A, Galmessa U. Review on hygienic milk products practice and occurrence of mastitis in cowās milk. agricultural research & technology. Open Access J. 2018;18(2):1ā1. https://0-doi-org.brum.beds.ac.uk/10.19080/ARTOAJ.2018.18.556053.
Middleton JR, Saeman A, Fox LK, Lombard J, Hogan JS, Smith KL. The National Mastitis Council: a global organization for mastitis control and milk quality, 50 years and beyond. J Mammary Gland Biol Neoplasia. 2014;19(3ā4):241ā51. https://0-doi-org.brum.beds.ac.uk/10.1007/s10911-014-9328-6.
Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45:493ā6. DOI. https://0-doi-org.brum.beds.ac.uk/10.1093/ajcp/45.4_ts.493.
Dhakal IP, Dhakal P, Koshihara T, Nagahata H. Epidemiological and bacteriological survey of buffalo mastitis in Nepal. J Vet Med Sci. 2007;69(12):1241ā5. DOI. https://0-doi-org.brum.beds.ac.uk/10.1292/jvms.69.1241.
Chandrasekaran D, Venkatesan P, Tirumurugaan KG, Nambi AP, Thirunavukkarasu PS, Kumanan K, et al. Pattern of antibiotic resistant mastitis in dairy cows. Vet World. 2014;7(6). https://0-doi-org.brum.beds.ac.uk/10.14202/vetworld.2014.389-394.
Li L, Zhou L, Wang L, Xue H, Zhao X. Characterization of methicillin-resistant and-susceptible staphylococcal isolates from bovine milk in northwestern China. PLoS One. 2015;10(3):e0116699. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.pone.0116699.
Pu W, Su Y, Li J, Li C, Yang Z, Deng H, et al. High incidence of oxacillin-susceptible mecA-positive Staphylococcus aureus (OS-MRSA) associated with bovine mastitis in China. PLoS One. 2014;9(2):e88134. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.pone.0088134.
Girmay W, Gugsa G, Taddele H, Tsegaye Y, Awol N, Ahmed M, et al. Isolation and identification of methicillin-resistant Staphylococcus aureus (MRSA) from Milk in Shire dairy farms, Tigray, Ethiopia. Vet Med Int. 2020;2020:1ā7. https://0-doi-org.brum.beds.ac.uk/10.1155/2020/8833973.
Algammal AM, Enany ME, El-Tarabili RM, Ghobashy MO, Helmy YA. Prevalence, Antimicrobial Resistance Profiles, Virulence and Enterotoxin-Determinant Genes of MRSA Isolated from Subclinical Bovine Mastitis Samples in Egypt. Pathogens. 2020;5(5):362. https://0-doi-org.brum.beds.ac.uk/10.3390/pathogens9050362.
Venugopal N, Mitra S, Tewari R, Ganaie F, Shome R, Rahman H, et al. Molecular detection and typing of methicillin-resistant Staphylococcus aureus and methicillin-resistant coagulase-negative staphylococci isolated from cattle, animal handlers, and their environment from Karnataka, Southern Province of India. Vet World. 2019, 12(11):1760. https://0-doi-org.brum.beds.ac.uk/10.14202/vetworld.2019.1760-1768.
Fisher EA, Paterson GK. Prevalence and characterisation of methicillin-resistant staphylococci from bovine bulk tank milk in England and Wales. J Global Antimicrob Resist. 2020;22:139ā44. https://0-doi-org.brum.beds.ac.uk/10.1016/j.jgar.2020.01.013.
Marama A, Mamu G, Birhanu T. Prevalence and antibiotic resistance of Staphylococcus aureus mastitis in Holeta area, western Ethiopia. Global Vet. 2016;16(4):365ā70. https://0-doi-org.brum.beds.ac.uk/10.5829/idosi.gv.2016.16.04.10334.
Zhang L, Li Y, Bao H, Wei R, Zhou Y, Zhang H, et al. Population structure and antimicrobial profile of Staphylococcus aureus strains associated with bovine mastitis in China. Microb Pathog. 2016;97:103ā9. https://0-doi-org.brum.beds.ac.uk/10.1016/j.micpath.2016.06.005.
Memon J, Kashif J, Yaqoob M, Liping W, Yang Y, Hongjie F. Molecular characterization and antimicrobial sensitivity of pathogens from sub-clinical and clinical mastitis in eastern China. Prevalence. 2012;33(2):170ā4.
Martineau F, Picard FJ, Lansac N, MĆ©nard C, Roy PH, Ouellette M, et al. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob Agents Chemother. 2000;44(2):231ā8. https://0-doi-org.brum.beds.ac.uk/10.1128/AAC.44.2.231-238.2000.
Stegger Ć, Andersen PS, Kearns A, Pichon B, Holmes MA, Edwards G, et al. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clin Microbiol Infect. 2012;18(4):395ā400. https://0-doi-org.brum.beds.ac.uk/10.1111/j.1469-0691.2011.03715.x.
Livestock statistics of Nepal. Nepal: Ministry of Livestock Development; 2017. Available from: https://nepalindata.com/resource/livestock-statistics-of-nepal-2017%2D%2D/
Metcalfe C. In: Wayne W, editor. Biostatistics: A Foundation for Analysis in the Health Sciences. 7th ed: Daniel, Wiley; 1999. ISBN 0ā471ā16386-4. Available from: https://0-www-wiley-com.brum.beds.ac.uk/ennp/Biostatistics: +A+Foundation+for+Analysis+in+the+Health+Sciences,+11th +Edition-p-9781119496571.
Antimicrobial Susceptibility tests. Mumbai 400 086, India: Himedia Laboratories. Pvt. Ltd; Literature Code: TL029_07/Antimicrobial Suscep. Sys./0518. Available from: https://www.himedialabs.com/HML/images/literature/pdf/100000027/68.pdf.
Manga I, VyletÄlovĆ” M. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains. Acta Univ Agri Silviculturae Mendelianae Brunensis. 2013;61(6):1785ā92. https://0-doi-org.brum.beds.ac.uk/10.11118/actaun201361061785.
Acknowledgements
The authors would like to acknowledge Dr. Milan Kandel and Dr. Lila Pathak for their help during sample collections. Likewise, the authors would like to thank laboratory assistant, Biswo Dawadi, for his help in the molecular study. The authors would also like to appreciate Dr. Rockson Karmacharya for his help to improve the grammatical parts. Finally, the authors acknowledge Jameson Mori, PhD, University of Illinois, Urbana-Champaign, Illinois, USA for language edits.
Funding
There was no funding available for this study.
Author information
Authors and Affiliations
Contributions
AS: Conceptualization, sample collection, laboratory work and preparation of first draft and revision of the manuscript. HBB: Overall supervision and conceptualization. RB: Guidance and supervision during study design and laboratory works and comments in the manuscript. HL: Supervised in the molecular part which was conducted in his lab and also provided comments in the manuscript. SK: Extensively revised the manuscript and provided critical comments. Helped in the second revision of the manuscript. All authors endorsed the final version. The author(s) read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
This study was reviewed and endorsed by the thesis advisory committee of the Agriculture and Forestry University, Chitwan, Nepal before the commencement of this study. Informal consent was obtained from the farmers and no individual identifiers of farmers were released. The data were analyzed after anonymizing the data. No interventions were done in the animals.
Consent for publication
Not applicable.
Competing interests
The authors declare that they do not have any competing interests.
Additional information
Publisherās Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1
Resistance profile of S. aureus isolates. Based on antibiotic susceptibility test of S. aureus against commonly used antibiotics, resistance profile of each isolates were determined. Altogether 23 different resistance profiles of isolates were determined.
Additional file 2.
Resistance profile of CoNS isolates. Based on antibiotic susceptibility test of CoNS against commonly used antibiotics, resistance profile of each isolates were determined. Altogether, 25 different resistance profiles of isolates were determined.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Shrestha, A., Bhattarai, R.K., Luitel, H. et al. Prevalence of methicillin-resistant Staphylococcus aureus and pattern of antimicrobial resistance in mastitis milk of cattle in Chitwan, Nepal. BMC Vet Res 17, 239 (2021). https://0-doi-org.brum.beds.ac.uk/10.1186/s12917-021-02942-6
Received:
Accepted:
Published:
DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12917-021-02942-6