Skip to content

Advertisement

  • Research article
  • Open Access

Epidemiological investigation of non-albicans Candida species recovered from mycotic mastitis of cows in Yinchuan, Ningxia of China

BMC Veterinary Research201814:251

https://doi.org/10.1186/s12917-018-1564-3

  • Received: 5 February 2018
  • Accepted: 8 August 2018
  • Published:

Abstract

Background

Candida spp. is the vital pathogen involved in mycotic mastitis of cows. However the epidemiology and infection of Candida species in mycotic mastitis of cow in Ningxia province of China has not been explored. In the present study, the epidemiology, antimicrobial susceptibility and virulence-related genes of non-albicans Candida (NAC) species were investigated.

Methods

A total of 482 milk samples from cows with clinical mastitis in four herds of Yinchuan, Ningxia were collected and used for the isolation and identification of mastic pathogens by phenotypic and molecular characteristics, and matrix-assisted laser desorption ionization-time of flight mass spectrometry. The antimicrobial susceptibility to antifungal agents was also determined by a disk diffusion assay. The presence of virulence-related genes was determined by polymerase chain reaction (PCR).

Results

A total of 60 isolates from nine different Candida species were identified from 256 (60/256, 23.44%) milk samples. The most frequently identified species in cows with clinical mastitis groups were Candida krusei (n = 14) and Candida parapsilosis (n = 6). Others include Candida lipolytica, Candida lusitaniae, Cryptococcus neoformans. But no Candida albicans was identified in this study. Interestingly, All C. krusei isolates (14/14) were resistant to fluconazole, fluorocytosine, itraconazole and ketoconazole, 2 out of 14 C. krusei were resistant to amphotericin, and 8 out of the 14 were resistant to nystatin. Similarly, all six C. parapsilosis isolates were resistant to fluorocytosine, but susceptible to fluconazole, ketoconazole and nystatin; two of the six were resistant amphotericin and itraconazole. Molecularly, all of the C. parapsilosis isolates carried eight virulence-related genes, FKS1, FKS2, FKS3, SAP1, SAP2, CDR1, ERG11 and MDR1. All of the C. krusei isolates contained three virulence-related genes, ERG11, ABC2 and FKS1.

Conclusion

These data suggested that Candida species other than C. albicans played a pathogenic role in mycotic mastitis of cows in Yinchuan, Ningxia of China. The high incidence of drug-resistant genes in C. parapsilosis and C. krusei also highlighted a great concern in public and animal health in this region.

Keywords

  • Mycotic mastitis
  • Candida parapsilosis
  • Candida krusei
  • Antimicrobial susceptibility
  • Virulent gene

Background

Cow mastitis is a disease caused by infections of a variety of microorganisms, which causes large economical looses and damages to the breeding industry by decreasing milk productivity and increasing costs of antibiotic treatments and culling [1]. In most cases, fungal infections of the mammary gland are mostly caused by yeast, the main genus of which is Candida [2]. Mastitis infections caused by fungi of the Candida genus have long been known in animals, and Candida-caused mycotic mastitis was firstly described by Fleischer in 1930 [3]. In this regard, Candida species are considered as opportunistic pathogens that colonize the cow udder. In addition, the harness and abuse of antibacterial agents, and treatments of contaminated antibiotic solutions, as well as duct, or other materials brought in contact with the mammary gland also favor yeast colonization in cow udders [4].

Recently, a large number of virulent factors have been found in C. parapsilosis and C. krusei originated from cow mastitis, including the Fksp subunits of the β-1,3-D-glucan synthase enzyme (FKS1, FKS2, and FKS3), aspartyl proteinases (SAPP1 and SAPP2), the ATP binding cassette (ABC) transporters, Candida drug resistance gene 1 (CDR1), major facilitator superfamily (MFS) transporter multiple drug resistance gene 1 (MDR1), 14α-demethylases (ERG11), efflux pump transporters (ABC1 and ABC2). These factors favor the survival and growth of Candida spp. in the mammary gland of cows.

The dairy industry is a predominant economics in Ningxia, a province in Western China. The mastitis of cows causes a significant economic loss in this region every year. It has been well documented that mycotic mastitis is an important causation of economic loss to the dairy industry, however the epidemiology of pathogens may vary in different areas. In this respect, there is a paucity of information about antimicrobial resistance and virulent factors of C. parapsilosis and C. krusei isolates in Ningxia of China, the aim of the present study is therefore to interrogate the epidemiology of fungal infection, and the antimicrobial susceptibility and virulence-related genes of Candida spp. in Yinchuan, Ningxia of China.

Methods

Isolation and identification of pathogens

This study was submitted to and approved by the Ethics Committee of Animal Study in Ningxia University. A total of 482 milk samples were collected from the cows with clinical mastitis, which originated from four herds in Yinchuan of Ningxia province, China. Clinical mastitis was defined by swelling, reduced milk flow, and abnormal milk appearance (watery to viscous with clots varying from gray-white to yellowish). Additionally, other signs of infection such as fever, inappetence, ataxia, and depression were also considered. The samples were first plated onto the Sabouraud dextrose broth and incubated at 37 °C for 48 h. The cultures were identified by morphological characteristics (formation of chlamydoconidium, pseudohyphae and germinal tube development), Gram staining, biochemical tests (growth in the presence of 0.1% cyclohexamide (SigmaTM), acidic pH tolerance, urea hydrolysis and carbohydrates assimilation and/or fermentation) and CHROMagar Candida culture [5]. All presumptive Candida species isolates were further confirmed by Matrix- assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) (VITEK® MS, BioMerieux, France).

Antimicrobial susceptibility tests

The antimicrobial susceptibility was determined by disk diffusion method according to the guideline of the Clinical Laboratory Standards Institute for antifungal susceptibility [6, 7]. A total of six antimicrobial agents were used to evaluate the antimicrobial resistance of the isolates, which included fluorocytosine (1 μg/disk), itraconazole (10 μg/disk), ketoconazole (15 μg/disk), fluconazole (25 μg/disk), nystatin (50 μg/disk), amphotericin (10 μg/disk). Results were recorded as resistant, intermediate and sensitive. The C. parapsilosis ATCC 22019 strain and C. krusei ATCC 6258 strain were used as references for C. parapsilosis strain and C. krusei, respectively.

Detection of virulence-related genes

The presence of virulence-related genes in C. parapsilosis and C. krusei isolates was detected by a PCR assay. The genes of interest, primer sequences, and expected size of fragment of PCR products were given in Tables 1 and 2. The PCR reactions were performed in a final volume of 25 μL of reaction mixture consisted of 50 ng of genomic DNA, 20 pmol of each primer, and 12.5 μL of 2× Taq PCR MasterMix containing 0.1 U of Taq polymerase/μL, 0.5 mM dNTP each, 20 mM Tris-HCl/pH 8.3, 100 mM KCl, 3 mM MgCl2 (Tiangen Biotech, Beijing, China). The cycling conditions were as following: an initial denaturation at 94 °C for 3 min; 30 cycles of denaturation at 94 °C for 30 s, annealing at distinct temperature (Tables 1 and 2) for 30 s, and primer extension at 72 °C for 1 min; and a final extension at 72 °C for 6 min.
Table 1

The PCR primers for amplification of C. parapsilosis virulence genes

Gene

Primer sequencea (5′–3′)a

Annealing temperature

Reference

FKS1

F: ATCCAAGATCTTCCGGTGCCTCAA

60°C

[8]

R: ATCAGCTGACCATGCTGGATATGG

FKS2

F: AATGGGCAGAGGTTGAGAAGGTAG

60°C

R: GGGTTCCAAGCAGGATATGGATCA

FKS3

F: TCGTAGGTTCGAATCCTGCTGAGA

60°C

R: ATGGTGAAGGCGCAACGGTGTAAA

SAPP1

F: ACTGGACAACAAATTGCAGATG

57°C

[9]

R: TAAACTGCTTCATTGCTGGTGT

SAPP2

F: GTCATATGGGGGATTTGCAC

57°C

R: CGCTTTGCTGATGTTACCAG

MDR1

F: TTCGTGATAGTTTTGGTGGTAG

62°C

[10]

R: TGAACCTGGAGTGAATCTTGT

CDR1

F: ATTTGCCGACATCCACCGTTAGG

60°C

[11]

R: ACCATGCTGTTTGCGAGTCCA

ERG11

F: GTACACCGTCATTACTCTACCCAACA

62°C

R: TGCTCCTTTCATTTACAACATCATTT

aF forward, R reverse

Table 2

The PCR primers for amplification of C. krusei virulence genes

Gene

Primer sequencea (5′–3′)a

Annealing temperature

Reference

FKS1

F: ACTGCATCGTTTGCTCCTCT

63°C

[12]

R: GAACATGATCAATTGCCAAC

 

ABC1

F: GATAACCATTTCCCACATTTGAGT

60°C

[13]

R: CATATGTTGCCATGTACACTTCTG

ABC2

F: CCTTTTGTTCAGTGCCAGATTG

60°C

R: GTAACCAGGGACACCAGCAA

ERG11

F: ATTGCGGCCGATGTCCAGAGGTAT

60°C

R: GCGCAGAGTATAAGAAAGGAATGGA

aF forward, R reverse

Results

Isolation and identification of COW mastitis pathogens

Total of 256 pathogenic yeasts were isolated from 482 milk samples collected from cows with clinical mastitis (256/482, 53.1%) in Yinchuan of Ningxia province. Among them, 60 (60/256, 23.44%) were identified in nine of Candida species, in which the C. krusei (23.33%, 14/60) and C. parapsilosis 10% (6/60) were two of the most frequent Candida species. In addition, 16.66% isolates (10/60) were classified as Candida-like species. Other identified Candida species included Candida lipolytica (5/60, 8.33%), Candida lusitaniae (5/60, 8.33%), Candida rugosa (4/60, 6.67%), Trichosporon mucoides (4/60, 6.67%), Candida sphaerica (3/60, 5%), Candida tropicalis (3/60, 5%) and Candida utilis (3/60, 5%).

CHROMagar Candida is a differential culture medium that allows selective isolation of yeasts and simultaneously identifies colonies of C. albicans, C. krusei, and other Candida spp. Results of this study confirm the accuracy of CHROMagar in providing a presumptive identification of C. krusei and C. parapsilosis, which was consistent with Odds and Bernaerts study [8]. These results of the preliminary identification on the CHROMagar Candida were agree with those by MALDI-TOF MS. C. krusei is the only species which grows on Sabouraud’s dextrose agar as spreading colonies with a matt or a rough whitish yellow surface, in contrast to the convex colonies of other Candida spp. All 14 isolates of C. krusei tested formed colonies after 48 h of incubation at 37 °C on CHROMagar Candida that were typically pale pink, large, rough, flat, and spreading with broad white edges (Fig. 1a). Unlike C. krusei, all 6 isolates of C. parapsilosis formed white or faint yellow, small, papillae, smooth colony (Fig. 1b). In addition, C. krusei and C. parapsilosis are both usually found in two basic morphological forms, as yeast and pseudohyphae (Fig. 1a’ and b’). Both were frequently present simultaneously in growing cultures and may not be separated easily.
Fig. 1
Fig. 1

Representative culture and Morphology of C. krusei and C. parapsilosis isolates. a Representative culture of C. krusei on CHROMagar plate; a’ the morphology of Giemsa staining for yeast and pseudohyphae of a C. krusei isolate in a; b Representative culture of C. parapsilosis on CHROMagar plate; b’ the morphology of Giemsa staining for yeast and pseudohyphae of a C. parapsilosis isolate in (b)

Antimicrobial susceptibility test

The antimicrobial susceptibility test demonstrated that C. krusei and C. parapsilosis isolates from cow mastitis cases in Yinchuan of Ningxia province had a variable degree of resistance to the antimicrobials (Fig. 2a and b, Tables 3 and 4). C. krusei isolates were respectively resistant to fluconazole (14/14, 100%), fluorocytosine (14/14, 100%), itraconazole (14/14, 100%), ketoconazole (14/14, 100%), amphotericin (2/14, 14.3%), and nystatin (8/14, 57.1%) (Table 3). C. parapsilosis isolates were respectively resistant to fluorocytosine (6/6, 100%), amphotericin (2/6, 33.3%), itraconazole (2/6, 33.3%), but susceptible to fluconazole (6/6, 100%), ketoconazole (6/6, 100%), nystatin (6/6, 100%) (Table 4).
Fig. 2
Fig. 2

Representative antimicrobial susceptibility tests by disk diffusion assay for C. krusei and C. parapsilosis isolates. a Representative disk diffusion assay for C. krusei isolate cultured on CHROMagar plate with indicated antimicrobial disks; b Representative disk diffusion assay for a C. parapsilosis isolate cultured on CHROMagar plate with indicated antimicrobial disks. Am, amphotericin; Fs, fluorocytosine; Fz, fluconazole; It, itraconazole; Ke, ketoconazole; Ny, nystatin

Table 3

Results of antimicrobial susceptibility tests of C. krusei isolates (n = 14)

Antibiotic

Resistant, % (no.)

Intermediate, % (no.)

Susceptible-dose dependent, SDD, % (no.)

Susceptible, % (no.)

Amphotericin

14.3 (n = 2)

85.7 (n = 12)

0

0

Fluorocytosine

100 (n = 14)

0

0

0

Fluconazole

100 (n = 14)

0

0

0

Itraconazole

100 (n = 14)

0

0

0

Ketoconazole

100 (n = 14)

0

0

0

Nystatin

0

42.9 (n = 6)

0

57.1 (n = 8)

Table 4

Results of antimicrobial susceptibility tests of C. parapsilosis isolates (n = 6)

Antibiotic

Resistant, % (no.)

Intermediate, % (no.)

Susceptible-dose dependent, SDD, % (no.)

Susceptible, % (no.)

Amphotericin

33.3 (n = 2)

0

33.3 (n = 2)

33.3 (n = 2)

Fluorocytosine

100 (n = 6)

0

0

0

Fluconazole

0

0

0

100 (n = 6)

Itraconazole

33.3 (n = 2)

0

66.7 (n = 4)

0

Ketoconazole

0

0

0

100 (n = 6)

Nystatin

0

0

0

100 (n = 6)

Detection of Virulence-related Genes

Three virulence-related genes in C. krusei and eight virulence-related genes in C. parapsilosis isolates were determined by PCR in the present study. The results indicated that all (14/14, 100%) C. krusei isolates contained the ERG11 gene, 12 out of 14 (85.7%) C. krusei isolates were positive in ABC2 and FKS1 genes, but no ABC1 gene was detected in these C. krusei isolates (Fig. 3). All (6/6, 100%) C. parapsilosis isolates carried the FKS1, FKS2, FKS3, CDR1, ERG11, SAPP1 and SAPP2 genes; 4 out of the 6 (66.7%) of C. parapsilosis isolates contained MDR1 gene (Fig. 4).
Fig. 3
Fig. 3

Virulence-related genes of C. krusei isolates determined by PCR assay. The indicated virulence-related genes of (a) FSK1, b ABC2 and (c) EGR11 in 14 field C. krusei isolates of this report were detected by PCR assay. C, control C. krusei ATCC6258 strain; lanes 1 to 14 represented C. krusei isolate 1–14. M, 50 bp DNA ladders

Fig. 4
Fig. 4

Virulence-related genes of C. parapsilosis isolates determined by PCR assay. The indicated virulence-related genes of (a) FSK1, b FSK2, c FSK3 (d) SAPP1, e SAPP2, f CDR1, g MDR1 and (h) EGR11 in 6 field C. parapsilosis isolates of this report were detected by PCR assay. c, C. parapsilosis ATCC22019 control strain; lanes 1 to 6 represented C. parapsilosis isolate 1–6. M, 2 kb DNA ladders

Discussion

In this study, Candida species of yeasts were isolated in the 23.44% (60/256) of all samples analyzed. This rate is a marginally higher than the rates reported in Turkey were 12.7% [9], 17.7% [10]; the rates reported in Brazil were 17.3% [4], 12.8% [11]; and the rate reported in Slovenia was 7.5% [12]. C. krusei was the predominant species isolated in this study, which was 23.33% (14/60) of the Candida isolates from those with clinical mastitis. However, there is some discrepancy among rates that were also reported by others. Pengov et al. reported a 34% [12], De&Marin et al. reported a 44.5% [4], and Sartori et al. reported a 34.6% [11] of C. krusei isolates from cows with mastitis. Their data reported a higher frequency of C. krusei infection than findings in this report. However, the rate of C. krusei isolates of our finding was higher than others. Ruz-Peres et al. reported a 18.18% [13], ErbaŞ et al. reported a 17.4% [10], Ksouri et al. reported a 15.57% [14], Krukowski et al. reported a 15.5% [15], and Eldesouky et al. reported a 12.2% of C. krusei isolates in cow mastitis [16].

C. parapsilosis was the second most frequent Candida species in this study. Although often being considered less virulent than C. albicans, C. parapsilosis is the Candida species with the largest increase in clinical incidence in human beings in recent decades. In animals, C. parapsilosis are also of great importance in veterinary medicine because of their ability to infect many animal species, including cows [14, 17, 18]. Indeed, many studies have described the isolation of C. parapsilosis from milk samples with a frequency varied from 1.7% to up to 25.4%, depending on the sanitary condition and environmental factors [10, 11, 15, 19].

The discrepancy in determination rates of Candida species among different geographic regions might be a consequence effect of several factors, such as the abuse of intramammary antibiotic treatment or the use of dairy farm made antibiotic infusions for mastitis treatments [15], yeast contaminated food or environment [20], inadequate sanitary practices of milking procedures, and the natural resistance to fluconazole of C. krusei [21, 22]. The relative cell-surface hydrophobicity (CSH) of C. parapsilosis, adherence to host tissues and plastic surfaces such as milkers or other prosthetic materials [2325], and the presence of pathogenic strains of C. krusei might also contribute the high rate of C. krusei and C. parapsilosis in milk samples of cow mastitis [26].

Of note, there was no C. albicans was identified in this study. This result was in accordance with the report by ErbaŞ et al. [10]. Although C. albicans was considered to be the most frequent cause of fungemia, a number of reports have documented infections caused by C. parapsilosis, C. krusei and other NAC species [27], suggesting that the pathogenic role of opportunistic NAC species in this disease. Therefore, it is a necessity to pay more attention in NAC species in order to establish the possible role in mycotic mastitis in the region of Yinchuan, Ningxia of China.

In this study, the antifungal resistance was also investigated. Notably, all of the six C. parapsilosis isolates (100%) were resistant to fluorocytosine, and all 14 of C. krusei isolates (100%) were resistant to ketoconazole, fluconazole, itraconazole and fluorocytosine. This finding was consistent with a study by Sonmez et al. [28], but was different from reports by others [2931]. Of interest, these agents are the primary agents against the infection of Candida species. It has been reported that the resistance of C. albicans to fluorocytosine was up to 10–30%, and the incidence of drug resistant NAC species was increased [10, 28]. For example, the natural or acquired resistance to fluconazole was confirmed in C. krusei and C. glabrata [32]. Our finding in C. krusei also supported the results reported in literatures. It was worthy to note that C. krusei and C. parapsilosis isolates from cow mastitis cases in Ningxia region were more resistant to antifungal agents. It is strongly recommended that fluorocytosine, and other azole antifungal agents should not be used in the treatment with NAC species in dairy cows in Ningxia province of China, owing to the high drug resistance of these Candida species. Interestingly, these isolates were from animals that had not been treated with antifungal agents, suggesting that animal isolates were more exposed to anthropic environmental selective pressures, such as the use of azole antifungals in agricultural practices [33]. Therefore, a special attention must be paid to dairy products for monitoring the antifungal susceptibility of Candida spp. and other fungi recovered from animals is extremely important, since they may act as reservoirs of strains causing human disease and may present a risk for immunocompromised patients [34].

Previous reports indicated that a large number of virulent factors have been determined in C. krusei and C. parapsilosis, including the β-1,3-D-glucan synthase enzyme, aspartyl proteinases, the ATP binding cassette (ABC) transporter, major facilitator superfamily (MFS) transporter, the zinc cluster transcription factor,14α-demethylase, efflux transporters. In the present study, we also observed that most of the C. krusei isolates harbored ERG11, ABC2 and FKS1 genes, and most of the C. parapsilosis isolates harbored genes of FKS1, FKS2, FKS3, SAPP1, SAPP2, ERG11, CDR1 and MDR1. The Fksp subunits of the β-1,3-D-glucan synthase enzyme are the target of echinocandins [35] and are encoded by the FKS1,FKS2, and FKS3 genes. Many reports indicated that a reduced-susceptibility (RES) to echinocandin was associated with mutations in two conserved regions of fks1 and fks2, and amino acid substitutions in the proteins encoded by these genes were observed within two or three hot spot (HS) regions on each gene [3638]. In the present study, FKS1, FKS2, and FKS3 genes were detected in all C. parapsilosis field isolates. 85.7% (12/14) of C. krusei isolates were positive in FKS1 gene. Further studies are needed to confirm the mutation in hot spot (HS) regions on FKS1, FKS2 genes of C. krusei and C. parapsilosis, in order to elucidate the capability of the M27-A3 guidelines to detect the resistance to echinocandin. The secretion of aspartyl proteinases (Saps) has been considered as important elements of virulence for C. albicans [39], and it is also recognized as virulence factors for C. parapsilosis [40]. In C. parapsilosis, SAPP1, and SAPP2 are two annotated secreted aspartyl proteinase genes [4143]. These enzymes are involved in providing nutrients for pathogen propagation, tissue colonization and further tissue invasion by rupturing host mucosal membranes [23]. In this study, 100% of C. parapsilosis isolates were found to carry SAPP1 and SAPP2 genes. This result was in agreement with previous reports [44].

The common mechanisms of Candida resistant to azoles include changes in target enzyme and upregulation of multidrug resistance protein (MDR). The target enzyme of azoles is 14α-lanosterol demethylase (14-DM), which is responsible for the production of an ergosterol precursor and is encoded by the gene ERG11. In C. albicans and C. parapsilosis, the efflux pump genes associated with azole resistance include CDR1, CDR2, and MDR1 [45]. However, the drug-resistant genes in C. krusei are involved in ABC1 and ABC2 [46, 47]. The results in this study also showed that 100% of C. parapsilosis isolates contained the CDR1 and ERG11 genes, and 66.7% of C. parapsilosis isolates contained the MDR1 gene. 100% (14/14) of C. krusei isolates contained the ERG11 gene, and 85.7% (12/14) of C. krusei isolates contained the ABC2 gene, despite the ABC1 gene was not detect in C. krusei. This finding was in line with previous studies in humans by He et al. that ABC2p was suggested to play a more important role in the resistance of C. krusei to azoles, instead of ABC1p [46].

Taken together, it was demonstrated that C. krusei and C. parapsilosis isolates from mycotic mastitis were present in Yinchuan of Ningxia with a potential of multidrug resistance. Further studies are needed to confirm mutations in ERG11, gain-of-function mutations in transcription factors, such as multidrug resistance regulator 1 (MRR1) and transcriptional activator of CDR gene 1 (TAC1), and the overexpression of these genes to elucidate the molecular mechanisms of resistance which caused by C. krusei and C. parapsilosis isolates from mycotic mastitis presented in Yinchuan, Ningxia of China.

Conclusions

A total of 60 isolates obtained from clinical mastitis milk samples in Yinchuan, Ningxia province of China were identified as Candida species according to phenotypic characteristics and MALDI-TOF MS. The most frequent Candida species found in this study was C. krusei, followed by C. parapsilosis. Other non-albicans Candida (NAC) species were also found in a low frequency. There was no Candida albicans was isolated in this study. According to results of this study, NAC may play an important pathogenic role in mycotic mastitis in dairy farms of Yinchuan region in Ningxia province of China. The C. krusei and C. parapsilosis displayed a strong antifungal resistance with drug-resistant genes. Most of C. krusei isolates harbored the ERG11, ABC2 and FKS1 genes, and most of the C. parapsilosis isolates harbored the FKS1, FKS2, FKS3, SAPP1, SAPP2, ERG11, CDR1 and MDR1 genes.

Abbreviations

14-DM: 

14α-lanosterol demethylase (14-DM)

ABC: 

ATP binding cassette

ATCC: 

American Type Culture Collection;

C.: 

Candida

CDR1: 

Candida drug resistance gene 1

CSH: 

Cell-surface hydrophobicity

ERG11: 

14α-demethylases

FKS: 

Fksp subunits of the β-1,3-D-glucan synthase enzyme

MALDI-TOF MS: 

Matrix-assisted laser desorption ionization-time of flight mass spectrometry

MDR1: 

Multiple drug resistance gene 1

MFS: 

Major facilitator superfamily

MRR1: 

Multidrug resistance regulator 1

NAC: 

Non-albicans Candida

PCR: 

Polymerase chain reaction

SAP: 

Secreted aspartyl proteinase

ssp.: 

Species

TAC1: 

Transcriptional activator of CDR gene 1

Declarations

Acknowledgements

The authors warmly thank to all study participants, owners of farms, veterinarians and personnel of the Center of Disease Control and Veterinary Institute in Ningxia Hui Autonomous Region of China, who helped in the realization of this study.

Funding

This study was supported by a grant from the National Natural Science Foundation of China (No.31660728), a grant from the project for the First-class discipline construction (Biology) of Ningxia Universities (NXYLXK2017B05), Major Innovation Projects for Building First-class Universities in Western China (ZKZD2017001) and a grant from Natural Science Foundation of Ningxia (NZ15017). These funding play no role in in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors’ contributions

JD, YW and XZ conceived and designed the experiments; JD and XW analyzed the data and drafted the manuscript; JD, HL, XL and JW performed experiments and acquired data; YW and XZ interpreted data and critically revised the manuscript. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

This study was conducted in accordance with the Law on Animal Protection and Welfare of Ningxia Hui Autonomous Region of China. Samples were recovered after acquiring the permission from study participants. Since only the milk samples but not mammary tissues were harvested in this study, all owners of farmers who participated in this provided their verbal consent to participate in this study. This study was submitted to and approved by the Ethics Committee of Animal Study in Ningxia University.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Key Laboratory of the Ministry of Education for the Conservation and Utilization of Special Biological Resources of Western China, Ningxia University, Yinchuan, 750021, Ningxia, China
(2)
College of Life science, Ningxia University, Yinchuan, 750021, Ningxia, China

References

  1. Costa EO, Ribeiro AR, Watanabe ET, Melville PA. Infectious bovine mastitis caused by environmental organisms. Zentralbl Veterinarmed B. 1998;45(2):65.PubMedGoogle Scholar
  2. Dworeckakaszak B, Krutkiewicz A, Szopa D, Kleczkowski M, Biegańska M. High Prevalence of Candida Yeast in Milk Samples from Cows Suffering from Mastitis in Poland. Scientific World Journal. 2012;2012(1):196347.Google Scholar
  3. Costa EO, Gandra CR, Pires MF, Coutinho SD, Castilho W, Teixeira CM. Survey of bovine mycotic mastitis in dairy herds in the state of Sao Paulo, Brazil. Mycopathologia. 1993;124(1):13–7.View ArticlePubMedGoogle Scholar
  4. De CSR, Marin JM. Isolation of Candida spp. from mastitic bovine milk in Brazil. Mycopathologia. 2005;159(2):251–3.View ArticleGoogle Scholar
  5. Pfaller MA, Houston, Coffmann. Application of CHROMagar Candida for rapid screening of clinical specimens for Candida albicans, Candida tropicalis, Candida krusei, and Candida (Torulopsis) glabrata. J Clin Microbiol. 1996;34(1):58–61.PubMedPubMed CentralGoogle Scholar
  6. CLSI. Method for antifungal disk diffusion susceptibility testing of yeasts; approved guideline. Wayne: Clinical and Laboratory Standards Institute; 2004.Google Scholar
  7. CLSI. Zone diameter interpretive standards, corresponding minimal inhibitory concentration (MIC) interpretive breakpoints, and quality control limits for antifungal disk diffusion susceptibility testing of yeasts; informational supplement. 2nd ed. Wayne: Clinical and Laboratory Standards Institute; 2008.Google Scholar
  8. Odds FC, Bernaerts R. CHROMagar Candida, a new differential isolation medium for presumptive identification of clinically important Candida species. J Clin Microbiol. 1994;32(8):1923.PubMedPubMed CentralGoogle Scholar
  9. Seker E. Identification of Candida species isolated from bovine mastitic milk and their in vitro hemolytic activity in western Turkey. Mycopathologia. 2010;169(4):303–8.View ArticlePubMedGoogle Scholar
  10. ErbaŞ G, Parin U, Kirkan Ş, SavaŞAn S, ÖZavci MV, YÜKsel HT. Identification of Candida strains with nested PCR in bovinemastitis and determination of antifungal susceptibilities. Turk J Vet Anim Sci. 2017;41:757–63.View ArticleGoogle Scholar
  11. Sartori LCA, Santos RC, Marin JM. Identification of Candida species isolated from cows suffering mastitis in four Brazilian states. Arquivo Brasileiro De Medicina Veterinária E Zootecnia. 2014;66(5):1615–7.View ArticleGoogle Scholar
  12. Pengov A. Prevalence of mycotic mastitis in cows. Acta Veterinaria. 2002;52(2):133–6.Google Scholar
  13. Ruz-Peres M, Benites NR, Yokoya E, Melville PA. Resistência de fungos filamentosos e leveduras isolados de leite CRU bovino à pasteurização e fervura. Vet Zootec. 2010;17(1):62–70.Google Scholar
  14. Ksouri S, Djebir S, Hadef Y, Benakhla A. Survey of bovine mycotic mastitis in different mammary gland statuses in two north-eastern regions of Algeria. Mycopathologia. 2015;179(3–4):327–31.View ArticlePubMedGoogle Scholar
  15. Krukowski H, Tietze M, Majewski T, Różański P. Survey of yeast mastitis in dairy herds of small-type farms in the Lublin region, Poland. Mycopathologia. 2001;150(1):5–7.View ArticlePubMedGoogle Scholar
  16. Eldesouky I, Mohamed N, Khalaf D, Salama A, Elsify A, Ombarak R, Elballal S, Effat M, Alshabrawy M. Candida mastitis in dairy cattle with molecular detection of Candida albicans. Kafkas Üniversitesi Veteriner FakÜltesi Dergisi. 2016;22(3):461–4.Google Scholar
  17. Costa GMD, Silva ND, Rosa CA, Pereira UDP. Mastite por leveduras em bovinos leiteiros do Sul do Estado de Minas Gerais, Brasil mastitis caused by yeasts in dairy herds in the south of the Minas Gerais state, Brazil. Ciência Rural. 2008;38(7):1938–42.View ArticleGoogle Scholar
  18. Fadda ME, Pisano MB, Scaccabarozzi L, Mossa V, Deplano M, Moroni P, Liciardi M, Cosentino S. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection. J Dairy Sci. 2013;96(12):7692.View ArticlePubMedGoogle Scholar
  19. Zaragoza CS, Olivares RA, Watty AE, Moctezuma Ade L, Tanaca LV. Yeasts isolation from bovine mammary glands under different mastitis status in the Mexican high Plateu. Revista iberoamericana de micologia. 2011;28(2):79–82.View ArticlePubMedGoogle Scholar
  20. Elad D, Shpigel NY, Winkler M, Klinger I, Fuchs V, Saran A, Faingold D. Feed contamination with Candida krusei as a probable source of mycotic mastitis in dairy cows. J Am Vet Med Assoc. 1995;207(5):620.PubMedGoogle Scholar
  21. Freydiere AM, Guinet R, Boiron P. Yeast identification in the clinical microbiology laboratory: phenotypical methods. Med Mycol. 2001;39(1):9.View ArticlePubMedGoogle Scholar
  22. Pfaller MA, Andes DR, Diekema DJ, Horn DL, Reboli AC, Rotstein C, Franks B, Azie NE. Epidemiology and outcomes of invasive candidiasis due to non-albicans species of Candida in 2,496 patients: data from the prospective antifungal therapy (PATH) registry 2004-2008. PLoS One. 2014;9(7):e101510.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Trofa D, Gacser A, Nosanchuk JD. Candida parapsilosis, an emerging fungal pathogen. Clin Microbiol Rev. 2008;21(4):606–25.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Kuhn DM. Comparison of biofilms formed by Candidaalbicans and Candidaparapsilosis on bioprosthetic surfaces. Infect Immun. 2002;70(2):878–88.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Panagoda GJ, Ellepola AN, Samaranayake LP. Adhesion of Candida parapsilosis to epithelial and acrylic surfaces correlates with cell surface hydrophobicity. Mycoses. 2001;44(1–2):29.View ArticlePubMedGoogle Scholar
  26. Spanamberg A, Jr WE, Brayer Pereira DI, Argenta J, Cavallini Sanches EM, Valente P, Ferreiro L. Diversity of yeasts from bovine mastitis in southern Brazil. Revista iberoamericana de micologia. 2008;25(3):154–6.View ArticlePubMedGoogle Scholar
  27. Rodríguez D, Almirante B, Cuenca-Estrella M, Rodríguez-Tudela JL, Mensa J, Ayats J, Sanchez F, Pahissa A. Predictors of candidaemia caused by non-albicans Candida species: results of a population-based surveillance in Barcelona, Spain. Clin Microbiol Infect. 2010;16(11):1676.View ArticlePubMedGoogle Scholar
  28. Sonmez M, Erbas G. Isolation and identification of Candida spp. from mastitis cattle milk and determination of antifungal susceptibilities. Int J Vet Sci. 2017;6(2):104–7.Google Scholar
  29. Tavanti A, Hensgens LA, Mogavero S, Majoros L, Senesi S, Campa M. Genotypic and phenotypic properties of Candida parapsilosis sensu strictu strains isolated from different geographic regions and body sites. BMC Microbiol. 2010;10(1):1–11.View ArticleGoogle Scholar
  30. Wawron W, Bochniarz M, Dabrowski R. Antifungal susceptibility of yeasts isolated from secrection of inflamed mammary glands in cows. Pol J Vet Sci. 2010;13(3):487–90.PubMedGoogle Scholar
  31. Xiao M, Fan X, Chen SC, Wang H, Sun ZY, Liao K, Chen SL, Yan Y, Kang M, Hu ZD. Antifungal susceptibilities of Candida glabrata species complex, Candida krusei, Candida parapsilosis species complex and Candida tropicalis causing invasive candidiasis in China: 3 year national surveillance. J Antimicrob Chemother. 2015;70(3):802.View ArticlePubMedGoogle Scholar
  32. Gunes I, Kalkanci A, Kustimur S. Comparison of three different commercial kits with conventional methods for the identification of Candida strains to species level. Mikrobiyoloji Bulteni. 2001;35(4):559–64.Google Scholar
  33. Rocha MF, Alencar LP, Paiva MA, Melo LM, Bandeira SP, Ponte YB, Sales JA, Guedes GM, Castelo-Branco DS, Bandeira TJ, et al. Cross-resistance to fluconazole induced by exposure to the agricultural azole tetraconazole: an environmental resistance school? Mycoses. 2016;59(5):281–90.View ArticlePubMedGoogle Scholar
  34. Edelmann A, Krüger M, Schmid J. Genetic relationship between human and animal isolates of Candida albicans. J Clin Microbiol. 2005;43(12):6164–6.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Douglas CM, D'Ippolito JA, Shei GJ, Meinz M, Onishi J, Marrinan JA, Li W, Abruzzo GK, Flattery A, Bartizal K. Identification of the FKS1 gene of Candida albicans as the essential target of 1,3-beta-D-glucan synthase inhibitors. Antimicrob Agents Chemother. 1997;41(11):2471.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Garcia-Effron G, Katiyar SK, Park S, Edlind TD, Perlin DS. A naturally occurring proline-to-alanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis accounts for reduced echinocandin susceptibility. Antimicrob Agents Chemother. 2008;52(7):2305.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Martícarrizosa M, Sánchezreus F, March F, Cantón E, Coll P. Implication of Candida parapsilosis FKS1 and FKS2 mutations in reduced Echinocandin susceptibility. Antimicrob Agents Chemother. 2015;59(6):3570–3.View ArticleGoogle Scholar
  38. Prigitano A, Esposito MC, Cogliati M, Pitzurra L, Santamaria C, Tortorano AM. Acquired echinocandin resistance in a Candida krusei blood isolate confirmed by mutations in the fks1 gene. New Microbiol. 2014;37(2):237–40.PubMedGoogle Scholar
  39. Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted Aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev. 2003;67(3):400.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Horváth P, Nosanchuk JD, Hamari Z, Vágvölgyi C, Gácser A. The identification of gene duplication and the role of secreted aspartyl proteinase 1 in Candida parapsilosis virulence. J Infect Dis. 2012;205(6):923.View ArticlePubMedGoogle Scholar
  41. Dostál J, Dlouhá H, Malon P, Pichová I, Hrusková-Heidingsfeldová O. The precursor of secreted aspartic proteinase Sapp1p from Candida parapsilosis can be activated both autocatalytically and by a membrane-bound processing proteinase. Biol Chem. 2005;386(8):791.View ArticlePubMedGoogle Scholar
  42. Merkerová M, Dostál J, Hradilek M, Pichová I. Cloning and characterization of Sapp2p, the second aspartic proteinase isoenzyme from Candida parapsilosis. FEMS Yeast Res. 2006;6(7):1018–26.View ArticlePubMedGoogle Scholar
  43. Hrusková-Heidingsfeldová O, Dostál J, Majer F, Havlíkova J, Hradilek M, Pichová I. Two aspartic proteinases secreted by the pathogenic yeast Candida parapsilosis differ in expression pattern and catalytic properties. Biol Chem. 2009;390(3):259–68.View ArticlePubMedGoogle Scholar
  44. Dabiri S, Shams-Ghahfarokhi M, Razzaghi-Abyaneh M. SAP(1-3) gene expression in high proteinase producer Candida species strains isolated from Iranian patients with different Candidosis. J Pure Appl Microbiol. 2016;10(3):1891–6.Google Scholar
  45. Chen LM, Xu YH, Zhou CL, Zhao J, Li CY, Wang R. Overexpression of CDR1 and CDR2 genes plays an important role in fluconazole resistance in Candida albicans with G487T and T916C mutations. J Int Med Res. 2010;38(2):536.View ArticlePubMedGoogle Scholar
  46. He X, Zhao M, Chen J, Wu R, Zhang J, Cui R, Jiang Y, Chen J, Cao X, Xing Y. Overexpression of both ERG11 and ABC2 genes might be responsible for Itraconazole resistance in clinical isolates of Candida krusei. PLoS One. 2015;10(8):e0136185.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Katiyar SK, Edlind TD. Identification and expression of multidrug resistance-related ABC transporter genes in Candida krusei. Med Mycol. 2001;39(39):109–16.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement