Expression kinetics of natural resistance associated macrophage protein (NRAMP) genes in Salmonella Typhimurium-infected chicken

Table 1 List of primers used for real time PCR

Target	Primer sequence (5′ → 3′)		Size of Amplicon	T_{m °C}	Reference
β Actin	Forward primer	TGGCATTGCTGACAGGAT	160 bp	63.1	[24]
β Actin	Reverse primer	CTGCTTGCTGATCCACAT	160 bp	60.0	[24]
NRAMP1	Forward primer	CCCCCACATCACCCCGTCC	180 bp	74.2	[24]
NRAMP1	Reverse primer	GGCCCCACACTGCAGGTCTGAC	180 bp	74.4	[24]
NRAMP2	Forward primer	GTACTCAGGGCAGTTCGTCA	162 bp	63.0	This study
NRAMP2	Reverse primer	GCACGTTGAGGAAGTCGTTC	162 bp	64.8	This study

ISSN: 1746-6148