From: First clinical case report of Cytauxzoon sp. infection in a domestic cat in France
Primer names | Primers sequences | Product size bp | PCR conditions | Reference |
---|---|---|---|---|
Nested PCR: BTF1(external) BTR1 (external) | GGCTCATTACAACAGTTATAG CCCAAAGACTTTGATTTCTCTC | 930 bp | 94 °C 3 min, 58 °C 1 min 72 °C 2 min 45 cycles: 94 °C 30s, 58 °C 20s 72 °C 30s 72 °C 7 min | [17] |
BTF2 (internal) BTR2 (internal) | CCGTGCTAATTGTAGGGCTAATAC GGACTACGACGGTATCTGATCG | 836 bp | Same conditions for the secondary round with an annealing temperature of 62 °C | |
Paraseq1F_scanelis 18seq1R_scanelis | TGGCTCATTAMAACAGTTATAGTTTA AGACAAATCRCTCCACCAAC | 1188 | 94 °C 3 min 45 cycles: 94 °C 20 s 56 °C 30 s 72 °C 45 s 72 °C 7 min | Unpublished |
Piro-A Piro-B | AAT ACC CAA TCC TGACAC AGG G TTA AAT ACG AAT GCC CCC AAC | 408 bp | 94 °C 1 min 39 cycles 94 °C 45 s, 62 °C 45 s, 72 °C 45 s. 72 °C 7 min | [18] |