From: Detection and molecular characterisation of bovine corona and toroviruses from Croatian cattle
PRIMER NAME | SEQUENCE (5’ → 3’) | SIZE (bp) and location of amplicon | GENOME POSITIONa | REFERENCE |
---|---|---|---|---|
BCoV F | CCGATCAGTCCGACCAATC | 460 | 29476–29494 | [46] |
BCoV R | TAGTCGGAATAGCCTCATCGC | BCoV N gene | 29899–29919 | |
S-S1 | GATAAGTTTGCTATACCCAATGG | 1194 | 24817–24839 | [47] |
S-AS1 | ACTATCATTTACTGAATTAACAG | BCoV S gene | 25988–26010 | |
TORO S5 | GTGTTAAGTTTGTGCAAAAAT | 741 | 20956–20976 | [5] |
TORO S3 | TGCATGAACTCTATATGGTGT | BToV S gene | 21677–21697 |