Table 1 Primers and probes used in this study
From: Investigation of an outbreak of mycobacteriosis in pigs
Target | Size of amplified sequence (bp) | Primers and probes | GenBank accession no. |
|---|---|---|---|
IS1245 | 82 | Primer 41: ggtgagcggatcactcaag* Primer 116: ggagaagccccgatgaac Probe 3: caagccttgatcgacgcgga | L33879 |
IS6110 | 101 | Primer 149: gccaactacggtgtttacgg Primer 150: agtttggtcatcagccgttc Probe 6: gggcatcgaggtggccagat | X17348.1 |
Porcine β-globin gene | 119 | Primer 120: gggggttgcaatttattcct Primer 121: tgaatcacggtcctgtgaaa Probe 4: cgcagattcccaaaccttcgc | X86791 |